Stem-loop sequence cfa-mir-133c

Accession MI0010325
Description Canis familiaris miR-133c stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--     uuu    a       aa  u  a        aacug 
  aaugc   gcua agcuggu  aa gg accaaauc     u
  |||||   |||| |||||||  || || ||||||||      
  uuacg   cgau ucgacca  uu cc ugguuuag     u
ag     ugu    g       ac  c  c        guaac 
Get sequence
Genome context
Coordinates (CanFam2) Overlapping transcripts
chr24: 49536969-49537054 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-133c
cfa-mir-1-1 chr24: 49527546-49527604 [+]
cfa-mir-133c chr24: 49536969-49537054 [+]

Mature sequence cfa-miR-133c

Accession MIMAT0009833
Sequence

52 - 

uugguccccuucaaccagcug

 - 72

Get sequence
Evidence by similarity; MI0004835
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).