Stem-loop sequence cfa-mir-20b

AccessionMI0010322 (change log)
DescriptionCanis familiaris miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -g    -a           g     g   ucugg 
5'   uacc  aagugcucaca ugcag uag     g
     ||||  ||||||||||| ||||| |||     c
3'   augg  uucacgggugu auguc auc     u
   ca    cc           g     -   ucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 104896091-104896158 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-20b
cfa-mir-106achrX: 104896518-104896574 [-]
cfa-mir-18bchrX: 104896339-104896415 [-]
cfa-mir-20bchrX: 104896091-104896158 [-]
cfa-mir-19b-2chrX: 104895962-104896025 [-]
cfa-mir-92a-2chrX: 104895826-104895886 [-]
cfa-mir-363chrX: 104895657-104895723 [-]
Database links

Mature sequence cfa-miR-20b

Accession MIMAT0009830
Sequence

5 - 

caaagugcucacagugcaggua

 - 26

Get sequence
Evidence by similarity; MI0005015
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).