Stem-loop sequence osa-MIR1846c

AccessionMI0010321 (change log)
DescriptionOryza sativa miR1846c stem-loop
Gene family MIPF0000577; MIR1846
Literature search

5 open access papers mention osa-MIR1846c
(6 sentences)

Stem-loop
   -auga  c         c        g         c     a 
5'      gc gccggaucu ccagugag aggccgggg cgcug a
        || ||||||||| |||||||| ||||||||| |||||  
3'      cg cggccuagg ggucgcuc ucuggcccc guggc u
   agaaa  -         c        g         a     c 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 270780-270865 [+]
intergenic
Database links

Mature sequence osa-miR1846c-5p

Accession MIMAT0009165
Sequence

20 - 

agugaggaggccggggccgcu

 - 40

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence osa-miR1846c-3p

Accession MIMAT0009166
Sequence

49 - 

ugaccccggucugcucgcugg

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).
2
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).