Stem-loop sequence spu-mir-2006

AccessionMI0010276 (change log)
DescriptionStrongylocentrotus purpuratus miR-2006 stem-loop
Gene family MIPF0001936; mir-2006
Literature search

1 open access papers mention spu-mir-2006
(3 sentences)

Stem-loop
   gcc     a gu c      c         a  u   --------ug   a 
5'    guagc u  g caucgc accaagugu cu cag          gac u
      ||||| |  | |||||| ||||||||| || |||          |||  
3'    caucg g  c guggcg ugguucaca ga guc          cug a
   -cu     a ug c      a         c  -   uaaauuuuug   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914344.1: 40782-40875 [-]
intergenic
Database links

Mature sequence spu-miR-2006

Accession MIMAT0009747
Sequence

62 - 

gagcacacuugguagcggugcc

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).