Stem-loop sequence spu-mir-2005

AccessionMI0010275 (change log)
DescriptionStrongylocentrotus purpuratus miR-2005 stem-loop
Gene family MIPF0001956; mir-2005
Literature search

1 open access papers mention spu-mir-2005
(1 sentences)

Stem-loop
   cuacu        -       ca u        ga  g         u auau 
5'      ugucaauc uuuggug  g ccaauagg  gg cauugcagg g    u
        |||||||| |||||||  | ||||||||  || ||||||||| |    u
3'      acaguuag agaccau  c gguuaucc  uc gugacgucc c    g
   ---cu        u       ua u        --  g         - gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913462.1: 124766-124867 [+]
intergenic
Database links

Mature sequence spu-miR-2005

Accession MIMAT0009746
Sequence

22 - 

aguccaauagggagggcauugcag

 - 45

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).