Stem-loop sequence spu-mir-2004

AccessionMI0010274 (change log)
DescriptionStrongylocentrotus purpuratus miR-2004 stem-loop
Gene family MIPF0002042; mir-2004
Literature search

1 open access papers mention spu-mir-2004
(5 sentences)

Stem-loop
   aga       -      c          c   c    u      ga     
5'    ggcuacu ugcgga cuuucugugg ugu gugu aagugu  uucu 
      ||||||| |||||| |||||||||| ||| |||| ||||||  ||| a
3'    ccgaugg acguuu gaaggacacc aca caca uucaca  aagu 
   gua       c      u          a   -    c      -g     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN920588.1: 138611-138708 [-]
intergenic
Database links

Mature sequence spu-miR-2004

Accession MIMAT0009745
Sequence

61 - 

ucacacacaaccacaggaaguu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).