Stem-loop sequence spu-mir-2013

AccessionMI0010271 (change log)
DescriptionStrongylocentrotus purpuratus miR-2013 stem-loop
Gene family MIPF0001777; mir-2013
Stem-loop
   ---ugau    -    uu               ua        ---g   cgu 
5'        gucu acug  cuacgccgcuacauc  guugcauu    uga   c
          |||| ||||  |||||||||||||||  ||||||||    |||    
3'        caga ugac  gauguggugauguag  cgacguaa    acu   u
   accuuac    a    uc               ua        aggg   uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN920327.1: 71865-71965 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-2013
spu-mir-22KN920327.1: 73798-73883 [-]
spu-mir-2013KN920327.1: 71865-71965 [-]
Database links

Mature sequence spu-miR-2013

Accession MIMAT0009742
Sequence

61 - 

ugcagcaugauguaguggugu

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).