Stem-loop sequence spu-mir-2012

AccessionMI0010270 (change log)
DescriptionStrongylocentrotus purpuratus miR-2012 stem-loop
Gene family MIPF0000720; mir-2012
Literature search

1 open access papers mention spu-mir-2012
(2 sentences)

Stem-loop
   u    u    a      u    u          -uu    u 
5'  gggu cuug uaguac ggca auggacauug   guaa a
    |||| |||| |||||| |||| ||||||||||   |||| a
3'  uccg gaac gucaug cugu uacuuguaac   cauu u
   g    u    c      c    c          ucu    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913421.1: 189027-189110 [+]
intergenic
Database links

Mature sequence spu-miR-2012

Accession MIMAT0009741
Sequence

12 - 

uaguacuggcauauggacauug

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).