Stem-loop sequence spu-mir-2001

AccessionMI0010269 (change log)
DescriptionStrongylocentrotus purpuratus miR-2001 stem-loop
Gene family MIPF0000711; mir-2001
Literature search

1 open access papers mention spu-mir-2001
(1 sentences)

Stem-loop
   u g   a   g    a    a       -  a  a 
5'  u uca ugu accg uaua ugggcau ga ua u
    | ||| ||| |||| |||| ||||||| || ||  
3'  a agu aca uggc auau accugua cu gu c
   u g   a   g    g    g       a  a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN912884.1: 112621-112691 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-2001
spu-mir-2001KN912884.1: 112621-112691 [+]
spu-mir-252bKN912884.1: 119142-119242 [+]
spu-mir-252aKN912884.1: 120521-120621 [+]
Database links

Mature sequence spu-miR-2001

Accession MIMAT0009740
Sequence

7 - 

augugaccgauauaaugggcau

 - 28

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).