Stem-loop sequence sko-mir-2013

AccessionMI0010266 (change log)
DescriptionSaccoglossus kowalevskii miR-2013 stem-loop
Stem-loop
   uggaa   c      uu               u  u     g    aucu 
5'      uau ugcucu  acugcacaucgcuau uc ugcug cacc    g
        ||| ||||||  ||||||||||||||| || ||||| ||||    a
3'      aua augagg  ugacguguggugaug ag acgac gugg    u
   -acaa   a      --               u  u     -    aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL012876.1: 115044-115142 [-]
intergenic
Clustered miRNAs
< 10kb from sko-mir-2013
sko-mir-4834GL012876.1: 115381-115460 [-]
sko-mir-2013GL012876.1: 115044-115142 [-]
Database links

Mature sequence sko-miR-2013

Accession MIMAT0009737
Sequence

60 - 

ugcagcaugauguaguggugug

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).