Stem-loop sequence isc-mir-2001

AccessionMI0010250 (change log)
DescriptionIxodes scapularis miR-2001 stem-loop
Literature search

1 open access papers mention isc-mir-2001
(1 sentences)

Stem-loop
   uccugg      u    c   u   a       g   guc 
5'       ccgccu guga cgu aca ugggcau uug   c
         |||||| |||| ||| ||| ||||||| |||   a
3'       ggcggg cacu gca ugu acccgua gac   c
   ----ca      u    u   c   c       -   gug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS758004: 38911-38988 [-]
intergenic
Database links

Mature sequence isc-miR-2001

Accession MIMAT0009721
Sequence

12 - 

uugugaccguuacaaugggcaug

 - 34

Get sequence
Evidence by similarity; MI0010234

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).