Stem-loop sequence spu-mir-219

AccessionMI0010221 (change log)
DescriptionStrongylocentrotus purpuratus miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

1 open access papers mention spu-mir-219
(1 sentences)

Stem-loop
   ---uccau   a     cu        u     a     a      -   aa 
5'         gcg guguu  ccguugau guccg acgca uucuug uug  u
           ||| |||||  |||||||| ||||| ||||| |||||| |||  u
3'         cgc cauag  ggugacua caggc ugugu aagaac gau  u
   uccacgau   -     uu        -     a     c      u   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN915964.1: 41740-41840 [-]
intergenic
Database links

Mature sequence spu-miR-219-5p

Accession MIMAT0009685
Previous IDsspu-miR-219
Sequence

21 - 

ugauuguccgaacgcaauucuug

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence spu-miR-219-3p

Accession MIMAT0022953
Sequence

60 - 

agaacuguguacggacauca

 - 79

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2