Stem-loop sequence spu-mir-183

AccessionMI0010220 (change log)
DescriptionStrongylocentrotus purpuratus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

1 open access papers mention spu-mir-183
(2 sentences)

Stem-loop
   u  -    - u        a       ca    g  uu   u 
5'  cc ucgu c auggcacu uagaauu  cugu ug  gug u
    || |||| | |||||||| |||||||  |||| ||  |||  
3'  gg agua g uaccguga aucuugg  gaca au  uac g
   -  u    c u        c       uc    -  gg   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914066.1: 552684-552765 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-183
spu-mir-183KN914066.1: 552684-552765 [+]
spu-mir-96KN914066.1: 554245-554333 [+]
spu-mir-182KN914066.1: 557726-557806 [+]
Database links

Mature sequence spu-miR-183

Accession MIMAT0009684
Sequence

9 - 

uauggcacuauagaauucacug

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).