Stem-loop sequence cte-mir-2d-1

AccessionMI0010214 (change log)
Previous IDscte-mir-2d
DescriptionCapitella teleta miR-2d-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   cacccucauu       u   cu          -       uc   -u  c 
5'           gagaacc gca  ugaucaaggu ggcugug  uug  gu c
             ||||||| |||  |||||||||| |||||||  |||  || a
3'           uuuuugg cgu  acugguuucg ccgacac  aac  cg c
   ---ccacuac       u   uu          u       ua   uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB304652.1: 1031-1130 [+]
intergenic
Clustered miRNAs
< 10kb from cte-mir-2d-1
cte-mir-2e-1KB304652.1: 917-1016 [+]
cte-mir-2d-1KB304652.1: 1031-1130 [+]
Database links

Mature sequence cte-miR-2d

Accession MIMAT0009678
Previous IDscap-miR-2d
Sequence

60 - 

aaucacagccugcuuuggucau

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).