Stem-loop sequence lgi-mir-375

Accession MI0010212
Description Lottia gigantea miR-375 stem-loop
Gene family MIPF0000114; mir-375
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-375. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-375 microRNA is a short RNA molecule. MicroRNAs (miRNAs) are small (18-25 nucleotides), non-coding RNAs that regulate genes post-transcriptionally by inhibiting translation and/or causing mRNA degradation. miR-375 is found on human chromosome 2 in between the CRYBA2 and CCDC108 genes. miR-375 is specifically expressed in the pancreatic islets and brain. miR-375 was one of the first miRNAs identified in the pancreas (Poy et al, 2004), and remains one of the best characterised in terms of function. It is expressed in the pancreas and pituitary gland, organs linked by their role in hormone secretion, and expression levels increase during pancreas organogenesis. Loss-of-function studies showed that miR-375 is essential for β-cell formation in zebrafish (Kloosterman et al, 2007). miR-375 knockout mice have decreased numbers of β-cells and increased numbers of α-cells. The increase in glucagon levels, combined with the reduction in insulin levels, results in hyperglycaemia. This shows the importance of miR-375 in the establishment of normal pancreatic cell mass through the targeting of a group of genes which control cellular growth and proliferation in the developing pancreas (Poy et al, 2009). Further evidence for the involvement of miR-375 in pancreas development includes the fact that its expression is regulated by several transcription factors important in pancreatic development and function, including HNF6, INSM1, NGN3, NEUROD1, and PDX-1 (Keller et al, 2007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uaga  aaagug   -   -aac    c       uu  u        uuaaa 
    ga      guc gcc    ugac cgagccg  ug aacaaggc     u
    ||      ||| |||    |||| |||||||  || ||||||||      
    cu      cag cgg    auug gcucggc  gc uuguuuug     u
--ug  --gaaa   u   aaac    c       uu  -        uaaca 
Get sequence
Genome context
Coordinates (JGI1) Overlapping transcripts
sca_118: 35390-35490 [+]
intergenic

Mature sequence lgi-miR-375

Accession MIMAT0009676
Sequence

61 - 

uuuguucguucggcucgcguua

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).