Stem-loop sequence spu-mir-184

AccessionMI0010207 (change log)
DescriptionStrongylocentrotus purpuratus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

2 open access papers mention spu-mir-184
(3 sentences)

Stem-loop
   --------     u   cuu         -      u c     -   auacuau 
5'         gucuu uau   uccuuauca uucucu g ccggc cga       g
           ||||| |||   ||||||||| |||||| | ||||| |||       u
3'         cagaa aua   gggaauagu aagagg c ggucg guu       u
   acggugca     u   uuc         c      - a     c   aaaguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN920360.1: 189113-189214 [+]
intergenic
Database links

Mature sequence spu-miR-184

Accession MIMAT0009671
Sequence

62 - 

uggacggagaacugauaagggc

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).