Stem-loop sequence spu-mir-182

AccessionMI0010206 (change log)
DescriptionStrongylocentrotus purpuratus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Literature search

1 open access papers mention spu-mir-182
(1 sentences)

Stem-loop
   -   ucuauu         u  u     uca     -ua  cuc 
5'  gcc      uuuggcaau ga agaau   cacug   ac   a
    |||      ||||||||| || |||||   |||||   ||    
3'  ugg      gaaccguua cu ucuug   gugac   ug   u
   g   ---ucc         -  c     ---     uaa  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914066.1: 557726-557806 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-182
spu-mir-183KN914066.1: 552684-552765 [+]
spu-mir-96KN914066.1: 554245-554333 [+]
spu-mir-182KN914066.1: 557726-557806 [+]
Database links

Mature sequence spu-miR-182

Accession MIMAT0009670
Sequence

10 - 

uuuggcaauugauagaauucacacu

 - 34

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).