Stem-loop sequence spu-mir-133

AccessionMI0010204 (change log)
DescriptionStrongylocentrotus purpuratus miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention spu-mir-133
(9 sentences)

Stem-loop
   ---  cg  aa      c   uua      aaac   a        -  gaa 
5'    uc  ga  auguag gcu   gcuggu    ggg accaaauc gu   g
      ||  ||  |||||| |||   ||||||    ||| |||||||| ||   u
3'    ag  cu  uacguc cga   cgacca    ccc ugguuuag cg   a
   aac  au  --      a   ugc      acuu   c        g  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN918585.1: 456917-457017 [+]
intergenic
Database links

Mature sequence spu-miR-133

Accession MIMAT0009668
Sequence

60 - 

uuugguccccuucaaccagccgu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).