Stem-loop sequence spu-mir-125

AccessionMI0010203 (change log)
DescriptionStrongylocentrotus purpuratus miR-125 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention spu-mir-125
(3 sentences)

Stem-loop
   aaagaga   -     c      c       cc          a  ugcuuu 
5'        gac ugccc ccaaau ccugaga  cuaacuugug ug      u
          ||| ||||| |||||| |||||||  |||||||||| ||       
3'        cug gcggg gguuua ggacucu  gguuggacac ac      a
   ---cgua   u     u      a       au          -  uaaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914398.1: 1095315-1095415 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-125
spu-let-7KN914398.1: 1096279-1096379 [-]
spu-mir-125KN914398.1: 1095315-1095415 [-]
Database links

Mature sequence spu-miR-125-5p

Accession MIMAT0009667
Previous IDsspu-miR-125
Sequence

22 - 

ucccugagacccuaacuuguga

 - 43

Get sequence
Evidence experimental; 454 [1]

Mature sequence spu-miR-125-3p

Accession MIMAT0019161
Previous IDsspu-miR-125*
Sequence

63 - 

acagguugguaucucaggaauu

 - 84

Get sequence
Evidence experimental; 454 [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).