Stem-loop sequence spu-mir-124

Accession MI0010202
Description Strongylocentrotus purpuratus miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However the topic result quite controversial since different reports described also a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cuucuuauc     -  -u    a            au        uauau 
         caucc cg  ucuu guguucacugug  ccuugauu     u
         ||||| ||  |||| ||||||||||||  ||||||||     c
         guggg gc  ggaa cguaaguggcgc  ggaauuaa     u
--cuuuaaa     a  uc    c            ac        caaaa 
Get sequence
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS001180|: 137053-137153 [-]
intergenic
Database links

Mature sequence spu-miR-124

Accession MIMAT0009666
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).