Stem-loop sequence spu-mir-96

AccessionMI0010201 (change log)
DescriptionStrongylocentrotus purpuratus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   -        -        u    c       ---------  ua    g 
5'  cuagucug uuuggcac agca auuuugc         ug  ccuc a
    |||||||| |||||||| |||| |||||||         ||  ||||  
3'  gguuagac gaaccgug uugu uagaacg         ac  ggag a
   a        c        u    a       ugugcuguu  uc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914066.1: 554245-554333 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-96
spu-mir-183KN914066.1: 552684-552765 [+]
spu-mir-96KN914066.1: 554245-554333 [+]
spu-mir-182KN914066.1: 557726-557806 [+]
Database links

Mature sequence spu-miR-96

Accession MIMAT0009665
Sequence

9 - 

uuuggcacuagcacauuuugc

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).