Stem-loop sequence spu-mir-92c

AccessionMI0010200 (change log)
DescriptionStrongylocentrotus purpuratus miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ----gua       -   a  u     u  g    u     u  uccac     a 
5'        gagggca gca gc ggucg ga gagu gcaau ug     augau a
          ||||||| ||| || ||||| || |||| ||||| ||     |||||  
3'        cucccgu cgu cg ccggc cu cuca cguua ac     uacua u
   acucuaa       u   c  u     c  g    -     u  -----     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN917153.1: 420245-420345 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-92c
spu-mir-92bKN917153.1: 421925-422025 [-]
spu-mir-92cKN917153.1: 420245-420345 [-]
spu-mir-92aKN917153.1: 419786-419885 [-]
Database links

Mature sequence spu-miR-92c

Accession MIMAT0009664
Sequence

61 - 

uauugcacucgucccggccugc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).