Stem-loop sequence spu-mir-92c

Accession MI0010200
Description Strongylocentrotus purpuratus miR-92c stem-loop
Gene family MIPF0000013; mir-25
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-92_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-92 microRNAs are short single stranded non-protein coding RNA fragments initially discovered incorporated into an RNP complex with a proposed role of processing RNA molecules and further RNP assembly. Mir-92 has been mapped to the human genome as part of a larger cluster at chromosome 13q31.3, where it is 22 nucleotides in length but exists in the genome as part of a longer precursor sequence. There is an exact replica of the mir-92 precursor on the X chromosome. MicroRNAs are endogenous triggers of the RNAi pathway which involves several ribonucleic proteins (RNPs) dedicated to repressing mRNA molecules via translation inhibition and/or induction of mRNA cleavage. miRNAs are themselves matured from their long RNA precursors by ribonucleic proteins as part of a 2 step biogenesis mechanism involving RNA polymerase 2. Most miRNAs are grouped into clusters in the human genome or within families that share functions, expression profiles, promotors, or are incorporated into the same ribonucleic protein. The purpose of having a variety of miRNAs in a single peace of RNA processing machinery is to act as complementary strands to the recognition elements of a variety of target RNA molecules. The recognition elements of target mRNAs are typically within the 3' untranslated regions and with 678 human miRNAs and 472 mouse miRNAs confidently identified so far (miRBASE) there are extensive efforts taking place using bioinformatics tools to scan genomes for potential recognition elements for families of miRNAs in order to identify potential target genes. Mir-92 is no exception and currently identified gene targets have been among those involved in cell cycle regulation and cell signalling, and thus necessary during all stages of mammalian development and essential for the proliferation of cells. miRNAs can be oncogenes or tumor suppressor genes depending on their targets while mir-92 has been implicated as the former in leukaemia forms AML and ALL, Hepatocellular carcinoma (HCC) and several other cancers. The search for non invasive tools for diagnosis and management of cancer is extremely important for reducing the world wide health burden of cancer. miRNAs show potential as biomarkers and can even be found circulating in the serum. Some circulating miRNAs are specific to tumour patients, while miR-92 on the other-hand is present in healthy individuals in the serum but levels are variable and appear to change in response to the onset of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----gua       -   a  u     u  g    u     u  uccac     a 
       gagggca gca gc ggucg ga gagu gcaau ug     augau a
       ||||||| ||| || ||||| || |||| ||||| ||     |||||  
       cucccgu cgu cg ccggc cu cuca cguua ac     uacua u
acucuaa       u   c  u     c  g    -     u  -----     a 
Get sequence
Deep sequencing
209 reads, 1 experiments
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS006901|: 295415-295515 [+]
intergenic
Database links

Mature sequence spu-miR-92c

Accession MIMAT0009664
Sequence

61 - 

uauugcacucgucccggccugc

 - 82

Get sequence
Deep sequencing 209 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).