Stem-loop sequence spu-mir-92b

AccessionMI0010199 (change log)
DescriptionStrongylocentrotus purpuratus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention spu-mir-92b
(2 sentences)

Stem-loop
   --------    a      gu  a     ac    c        - ---uu    u 
5'         ggug uugaug  ca gucgg  cgag gcaauguu g     ccuc a
           |||| ||||||  || |||||  |||| |||||||| |     ||||  
3'         ccac aacuac  gu cggcc  guuc cguuauaa c     ggag u
   uacuaaaa    -      uc  c     cu    a        g uuuuu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN917153.1: 421925-422025 [-]
intergenic
Clustered miRNAs
< 10kb from spu-mir-92b
spu-mir-92bKN917153.1: 421925-422025 [-]
spu-mir-92cKN917153.1: 420245-420345 [-]
spu-mir-92aKN917153.1: 419786-419885 [-]
Database links

Mature sequence spu-miR-92b-5p

Accession MIMAT0019160
Previous IDsspu-miR-92b*
Sequence

15 - 

aagucggaccgagcgcaauguu

 - 36

Get sequence
Evidence experimental; 454 [2]

Mature sequence spu-miR-92b-3p

Accession MIMAT0009663
Previous IDsspu-miR-92b
Sequence

61 - 

uauugcacuugucccggccugc

 - 82

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
2
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).
3