Stem-loop sequence spu-mir-71

AccessionMI0010196 (change log)
DescriptionStrongylocentrotus purpuratus miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

1 open access papers mention spu-mir-71
(1 sentences)

Stem-loop
   acag   c       -  u a u        u             ------  a 
5'     aau gguguuc cc g g gaaagaca ggguagugagauu      ug c
       ||| ||||||| || | | |||||||| |||||||||||||      || u
3'     uua ucauagg gg c c cuuuuugu cuuaucacucuaa      ac a
   -aca   u       u  u c -        -             caaaac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914598.1: 339455-339555 [+]
intergenic
Database links

Mature sequence spu-miR-71

Accession MIMAT0009660
Sequence

22 - 

ugaaagacauggguagugagauu

 - 44

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).