Stem-loop sequence spu-mir-34

AccessionMI0010195 (change log)
DescriptionStrongylocentrotus purpuratus miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ccu    ----    g       uc   ag      u         uuuucg 
5'    gauu    ggcu ccuuccu  ggc  uguagu agcugguug      a
      ||||    |||| |||||||  |||  |||||| |||||||||      c
3'    cuaa    cuga ggaagga  ccg  acgucg ucgaccaac      c
   -uu    aguu    -       cc   gg      u         cacuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN916283.1: 1153963-1154063 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-34
spu-mir-2002KN916283.1: 1144519-1144614 [+]
spu-mir-34KN916283.1: 1153963-1154063 [+]
Database links

Mature sequence spu-miR-34

Accession MIMAT0009659
Sequence

21 - 

cggcaguguaguuagcugguug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).