Stem-loop sequence spu-mir-33

AccessionMI0010194 (change log)
DescriptionStrongylocentrotus purpuratus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   au  -   -      ag     g        cg           ----    c 
5'   cu cuu ucuugu  ccaug ugcauugu  uugcauugcau    gugu u
     || ||| ||||||  ||||| ||||||||  |||||||||||    ||||  
3'   ga gaa agaacg  gguau acgugaca  aacgugaugua    caua c
   -c  c   u      ga     a        ag           uccc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913021.1: 69421-69521 [+]
intergenic
Database links

Mature sequence spu-miR-33

Accession MIMAT0009658
Sequence

21 - 

gugcauugucguugcauugcau

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).