Stem-loop sequence spu-mir-31

Accession MI0010193
Description Strongylocentrotus purpuratus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-uaca     -     g   a    ag   uu          ---    uu 
     aacca gugga aaa ggca  aug  ggcauagcug   ugau  a
     ||||| ||||| ||| ||||  |||  ||||||||||   ||||   
     uuggu cacuu uuu ccgu  uac  cugugucgac   auua  a
gcuug     u     a   a    ca   uu          cca    ua 
Get sequence
Deep sequencing
164 reads, 1 experiments
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS009922|: 252618-252716 [+]
intergenic
Database links

Mature sequence spu-miR-31

Accession MIMAT0009657
Sequence

19 - 

aggcaagauguuggcauagcu

 - 39

Get sequence
Deep sequencing 164 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).