Stem-loop sequence spu-mir-31

AccessionMI0010193 (change log)
DescriptionStrongylocentrotus purpuratus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -uaca     -     g   a    ag   uu          ---    uu 
5'      aacca gugga aaa ggca  aug  ggcauagcug   ugau  a
        ||||| ||||| ||| ||||  |||  ||||||||||   ||||   
3'      uuggu cacuu uuu ccgu  uac  cugugucgac   auua  a
   gcuug     u     a   a    ca   uu          cca    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN920491.1: 702236-702334 [+]
intergenic
Database links

Mature sequence spu-miR-31

Accession MIMAT0009657
Sequence

19 - 

aggcaagauguuggcauagcu

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).