Stem-loop sequence spu-mir-29a

AccessionMI0010192 (change log)
Previous IDsspu-mir-29
DescriptionStrongylocentrotus purpuratus miR-29 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention spu-mir-29a
(1 sentences)

Stem-loop
   ----caa           u  -      g         gauaguguucuguu 
5'        ucuuccucuac gc cugguu caacuggug              g
          ||||||||||| || |||||| |||||||||               
3'        agaaggggaug cg gacuaa guugaccac              u
   uacuccc           u  a      a         gaaucuagcugaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913988.1: 525307-525407 [+]
intergenic
Clustered miRNAs
< 10kb from spu-mir-29a
spu-mir-29aKN913988.1: 525307-525407 [+]
spu-mir-29bKN913988.1: 527422-527506 [+]
Database links

Mature sequence spu-miR-29a

Accession MIMAT0009656
Previous IDsspu-miR-29
Sequence

61 - 

aagcaccaguugaaaucagagc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).