Stem-loop sequence spu-mir-10

AccessionMI0010190 (change log)
DescriptionStrongylocentrotus purpuratus miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   uuucuucacu       cu    uca    u u    c          ---u  -   uuu 
5'           uuuuggg  uaca   accc g agau cgaauuugug    cc gag   c
             |||||||  ||||   |||| | |||| ||||||||||    || |||    
3'           aggaccc  augu   uggg c ucua gcuuagacac    gg cuc   u
   --------uc       -u    caa    u -    u          ugau  u   cgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN918371.1: 533814-533923 [+]
intergenic
Database links

Mature sequence spu-miR-10

Accession MIMAT0009654
Sequence

26 - 

aacccuguagauccgaauuugug

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).