Stem-loop sequence spu-mir-9

Accession MI0010189
Description Strongylocentrotus purpuratus miR-9 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   ac    -u -u  u   c        u        guauga       c 
 cau  ugac  c  gc uuu ucuuuggu aucuagcu      gugaugu a
 |||  ||||  |  || ||| |||||||| ||||||||      |||||||  
 gua  acug  g  cg gaa agaaacca uggaucga      uacuacg a
u   -c    uu uc  u   u        u        ----aa       u 
Get sequence
Deep sequencing
330 reads, 1 experiments
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS005572|: 184918-185018 [-]
intergenic
Database links

Mature sequence spu-miR-9

Accession MIMAT0009653
Sequence

21 - 

ucuuugguuaucuagcuguaug

 - 42

Get sequence
Deep sequencing 329 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).