Stem-loop sequence spu-mir-9

AccessionMI0010189 (change log)
DescriptionStrongylocentrotus purpuratus miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   u   ac    -u -u  u   c        u        guauga       c 
5'  cau  ugac  c  gc uuu ucuuuggu aucuagcu      gugaugu a
    |||  ||||  |  || ||| |||||||| ||||||||      |||||||  
3'  gua  acug  g  cg gaa agaaacca uggaucga      uacuacg a
   u   -c    uu uc  u   u        u        ----aa       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN915310.1: 590803-590903 [+]
intergenic
Database links

Mature sequence spu-miR-9-5p

Accession MIMAT0009653
Sequence

21 - 

ucuuugguuaucuagcuguaug

 - 42

Get sequence
Evidence experimental; 454 [1]

Mature sequence spu-miR-9-3p

Accession MIMAT0009661
Sequence

60 - 

auaaagcuagguuaccaaagau

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).