Stem-loop sequence spu-mir-7

AccessionMI0010187 (change log)
DescriptionStrongylocentrotus purpuratus miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   cau       g    -u   aa   u         g     -  gaaug 
5'    accucug cccu  ugg  gac agugauuuu uuguu gu     u
      ||||||| ||||  |||  ||| ||||||||| ||||| ||      
3'    uggagac gggg  acc  cug ucacuaaaa aacaa ca     c
   acc       a    uc   gg   -         -     u  agaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN915738.1: 14118-14213 [-]
intergenic
Database links

Mature sequence spu-miR-7

Accession MIMAT0009651
Sequence

17 - 

uggaagacuagugauuuuguugu

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).