Stem-loop sequence spu-mir-1

Accession MI0010186
Description Strongylocentrotus purpuratus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ccaua     -ugc  ua             ga        ---c   au 
     uccca    ca  acauacuucuuua  auuccaua    uga  c
     |||||    ||  |||||||||||||  ||||||||    |||   
     agggu    gu  uguaugaagaaau  uaagguau    acu  u
-cucc     caaa  ua             -g        cuca   cc 
Get sequence
Deep sequencing
156 reads, 1 experiments
Genome context
Coordinates (Spur2.1) Overlapping transcripts
gb|DS000902|: 262915-263010 [+]
intergenic
Database links

Mature sequence spu-miR-1

Accession MIMAT0009650
Sequence

60 - 

uggaauguaaagaaguauguau

 - 81

Get sequence
Deep sequencing 156 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).