Stem-loop sequence spu-mir-1

AccessionMI0010186 (change log)
DescriptionStrongylocentrotus purpuratus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ccaua     -ugc  ua             ga        ---c   au 
5'      uccca    ca  acauacuucuuua  auuccaua    uga  c
        |||||    ||  |||||||||||||  ||||||||    |||   
3'      agggu    gu  uguaugaagaaau  uaagguau    acu  u
   -cucc     caaa  ua             -g        cuca   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN918585.1: 337411-337506 [+]
intergenic
Database links

Mature sequence spu-miR-1

Accession MIMAT0009650
Sequence

60 - 

uggaauguaaagaaguauguau

 - 81

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).