Stem-loop sequence spu-mir-375

AccessionMI0010184 (change log)
DescriptionStrongylocentrotus purpuratus miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention spu-mir-375
(8 sentences)

Stem-loop
   -----------------------      c    u       ---u  -  auaa        g 
5'                        cgagcu aacg gcaaaac    ug ag    ggucagcu u
                          |||||| |||| |||||||    || ||    ||||||||  
3'                        gcucgg uugc uguuuug    ac uc    ccggucgg u
   cuaucacacugacguuaaacugc      c    u       ucgu  a  ---g        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913128.1: 231515-231614 [-]
intergenic
Database links

Mature sequence spu-miR-375

Accession MIMAT0009648
Sequence

62 - 

uuguucguucggcucgcgucaa

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).