Stem-loop sequence spu-mir-242

AccessionMI0010183 (change log)
DescriptionStrongylocentrotus purpuratus miR-242 stem-loop
Gene family MIPF0000731; mir-242_2
Stem-loop
   --uguaac    -     ggca      a gc uu         -  ucuu 
5'         acca ugucg    uugcgu g  g  gugcacagu gu    u
           |||| |||||    |||||| |  |  ||||||||| ||     
3'         uggu acggc    aaugca c  c  uacguguua ca    a
   cuaaucac    c     acua      c ua uc         a  uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN913955.1: 171576-171675 [+]
intergenic
Database links

Mature sequence spu-miR-242

Accession MIMAT0009647
Sequence

20 - 

uugcguaggcguugugcacagu

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).