Stem-loop sequence spu-mir-210

AccessionMI0010182 (change log)
DescriptionStrongylocentrotus purpuratus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   cuc             a    g        -----  -  a 
5'    guuaguugcuguc cgcg cacaagag     ag ca u
      ||||||||||||| |||| ||||||||     || ||  
3'    uagucagcgacag gugc guguucuc     uc gu c
   aca             c    -        acaua  u  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN917968.1: 222056-222132 [+]
intergenic
Database links

Mature sequence spu-miR-210

Accession MIMAT0009646
Sequence

52 - 

uugugcgugcgacagcgacuga

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).