Stem-loop sequence spu-mir-137

AccessionMI0010181 (change log)
DescriptionStrongylocentrotus purpuratus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention spu-mir-137
(15 sentences)

Stem-loop
   aug     ag            g       -   aa 
5'    auuac  guauucucgagu aauaaua cag  a
      |||||  |||||||||||| ||||||| |||   
3'    ugaug  cauaagaguucg uuauugu guc  a
   aua     ca            -       a   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Spur_4.2; GCA_000002235.3) Overlapping transcripts
KN914988.1: 310664-310735 [-]
intergenic
Database links

Mature sequence spu-miR-137

Accession MIMAT0009645
Sequence

47 - 

uauugcuugagaauacacguag

 - 68

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).