Stem-loop sequence sko-mir-133

Accession MI0010164
Description Saccoglossus kowalevskii miR-133 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ugcaa     a   g      a       aaauc  a        a   u 
     uugag ugu gugcug agcuggu     gg accaaauc uau a
     ||||| ||| |||||| |||||||     || |||||||| ||| c
     aacuu acg uacgau ucgacca     cc ugguuuag gua a
aacca     -   g      g       acuuc  c        -   a 
Get sequence
Deep sequencing
167 reads, 1 experiments
Database links

Mature sequence sko-miR-133

Accession MIMAT0009627
Sequence

61 - 

uugguccccuucaaccagcugu

 - 82

Get sequence
Deep sequencing 167 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).