Stem-loop sequence sko-mir-31

AccessionMI0010152 (change log)
DescriptionSaccoglossus kowalevskii miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   --aaaauuc      uu  -u  a     g   uu          ---u   g 
5'          gcaaau  ag  gg ggcaa aug  ggcauagcug    uuc a
            ||||||  ||  || ||||| |||  ||||||||||    |||  
3'          uguuug  uc  uc ccguu uac  cugugucgac    aag u
   cacugccac      uu  uu  -     a   uc          ugac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL014644.1: 76886-76986 [+]
intergenic
Database links

Mature sequence sko-miR-31

Accession MIMAT0009614
Sequence

21 - 

aggcaagauguuggcauagcug

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).