Stem-loop sequence sko-mir-29a

AccessionMI0010150 (change log)
DescriptionSaccoglossus kowalevskii miR-29a stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   agaaugu      a           gc     u      a     uacac 
5'        uguuau augggagacug  uuuau uggugc uggag     u
          |||||| |||||||||||  ||||| |||||| |||||      
3'        acagug uaccuuuugac  aagua accacg aucuc     u
   -----uu      a           ua     u      -     cuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL011876.1: 294682-294777 [+]
intergenic
Database links

Mature sequence sko-miR-29a

Accession MIMAT0009612
Sequence

61 - 

uagcaccauaugaaaucaguuu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).