Stem-loop sequence lgi-mir-281

AccessionMI0010135 (change log)
DescriptionLottia gigantea miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   uuucaagauucaa      -a  a           --     c      u gaa 
5'              gaucaa  cg ugaagggagca  ucugu gacagu u   u
                ||||||  || |||||||||||  ||||| |||||| |    
3'              cugguu  gc auuucucucgu  aggua cuguca a   u
   -----cacuuaaa      gg  c           ug     -      u aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB203274.1: 642909-643009 [-]
intergenic
Database links

Mature sequence lgi-miR-281-5p

Accession MIMAT0009594
Previous IDslgi-miR-281*
Sequence

26 - 

aagggagcaucugucgacagu

 - 46

Get sequence
Evidence by similarity; MI0000366

Mature sequence lgi-miR-281-3p

Accession MIMAT0009595
Previous IDslgi-miR-281
Sequence

61 - 

ugucauggaguugcucucuuua

 - 82

Get sequence
Evidence by similarity; MI0000366

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).