Stem-loop sequence lgi-mir-279

AccessionMI0010134 (change log)
DescriptionLottia gigantea miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   ggca  gg  aa   -auaaa       u    ag      g    --u  a 
5'     ga  uu  ccg      uggguga ugug  ucuggu caug   uc u
       ||  ||  |||      ||||||| ||||  |||||| ||||   || g
3'     cu  aa  ggc      accuacu acac  agauca guac   ag a
   --ua  aa  ag   gaagac       c    cu      -    ugc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB203275.1: 133209-133309 [-]
intergenic
Database links

Mature sequence lgi-miR-279

Accession MIMAT0009593
Sequence

61 - 

ugacuagauccacacucaucca

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).