Stem-loop sequence lgi-mir-184

AccessionMI0010126 (change log)
DescriptionLottia gigantea miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   gccaauuuaau     --     uu         c  g       -cg   aa 
5'            aucuu  ucacg  uccuuguca uu uucgucu   ucu  u
              |||||  |||||  ||||||||| || |||||||   |||  a
3'            uagag  ggugu  gggaauagu aa aggcagg   aga  u
   -----cgacuu     ug     uc         c  g       uca   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB200347.1: 549605-549705 [-]
intergenic
Database links

Mature sequence lgi-miR-184

Accession MIMAT0009585
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Evidence by similarity; MI0000354

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).