Stem-loop sequence lgi-mir-34

Accession MI0010111
Description Lottia gigantea miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----aa  gag  g    gg   u u          u   c    a   caug 
      ca   ug gugu  uuc g ggcagugugg uag uggu guu    a
      ||   || ||||  ||| | |||||||||| ||| |||| |||     
      gu   ac cgca  aag c ccguuacauc auc acca caa    u
cagcaa  aaa  a    -a   c -          u   -    a   aauu 
Get sequence
Genome context
Coordinates (JGI1) Overlapping transcripts
sca_10: 1151253-1151353 [+]
intergenic

Mature sequence lgi-miR-34

Accession MIMAT0009569
Sequence

22 - 

uggcagugugguuagcugguagu

 - 44

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).