Stem-loop sequence lgi-mir-31

AccessionMI0010109 (change log)
DescriptionLottia gigantea miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   aua    ----u          cua     g   uu           ---g   u 
5'    augu     ugaguccaga   ggcaa aug  ggcauagcuga    uca a
      ||||     ||||||||||   ||||| |||  |||||||||||    |||  
3'    uacg     guucggguuu   ucguu uac  cugugucgacu    agu u
   ---    uuguu          cua     a   -u           acca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB203019.1: 866068-866168 [-]
intergenic
Database links

Mature sequence lgi-miR-31

Accession MIMAT0009566
Sequence

21 - 

aggcaagauguuggcauagcu

 - 41

Get sequence
Evidence by similarity; MI0000089

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).