Stem-loop sequence lgi-mir-29

AccessionMI0010108 (change log)
DescriptionLottia gigantea miR-29 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   uucagaua   ua     ac    -u   c         a   a    uuca 
5'         ugu  ccauu  gggg  cug uuucaaaug ugu uaga    u
           |||  |||||  ||||  ||| ||||||||| ||| ||||    a
3'         aca  gguag  cucu  gac aaaguuuac acg aucu    a
   ---caacc   -c     aa    uu   u         c   -    ccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202283.1: 3136201-3136301 [+]
intergenic
Database links

Mature sequence lgi-miR-29

Accession MIMAT0009565
Sequence

61 - 

uagcaccauuugaaaucaguuu

 - 82

Get sequence
Evidence by similarity; MI0000105

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).