Stem-loop sequence lgi-mir-9

AccessionMI0010105 (change log)
DescriptionLottia gigantea miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --a    aaag u                 u        g      ugaaa 
5'    agug    c cuguuuuugucuuuggu aucuagcu uaugau     u
      ||||    | ||||||||||||||||| |||||||| ||||||      
3'    ucau    g gguaaaaacggaaacca uggaucga auauua     a
   auc    auca u                 u        a      caaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB200521.1: 1751408-1751509 [+]
intergenic
Database links

Mature sequence lgi-miR-9-5p

Accession MIMAT0009562
Previous IDslgi-miR-9
Sequence

21 - 

ucuuugguuaucuagcuguauga

 - 43

Get sequence
Evidence by similarity; MI0000468

Mature sequence lgi-miR-9-3p

Accession MIMAT0009572
Previous IDslgi-miR-79
Sequence

60 - 

auaaagcuagguuaccaaaggc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).