Stem-loop sequence lgi-mir-7

AccessionMI0010103 (change log)
DescriptionLottia gigantea miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   auaaccu   u   c        -    cua       u     uu    uu 
5'        auc acc uggucugg aaga   gugauuu guugu  uaau  c
          ||| ||| |||||||| ||||   ||||||| |||||  ||||   
3'        uag ugg guuagacc uucu   cacuaaa uaaca  auua  a
   acaauuc   u   u        c    -ua       -     --    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202094.1: 2110234-2110334 [-]
intergenic
Database links

Mature sequence lgi-miR-7

Accession MIMAT0009560
Sequence

21 - 

uggaagacuagugauuuuguuguu

 - 44

Get sequence
Evidence by similarity; MI0000127

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).