Stem-loop sequence lgi-mir-2d

AccessionMI0010102 (change log)
DescriptionLottia gigantea miR-2d stem-loop
Stem-loop
   uaucugaaa      u u c   cu    -      -     a      -   a 
5'          guauuu g c cug  cuga ccaagu ggcug gauaag uuu u
            |||||| | | |||  |||| |||||| ||||| |||||| |||  
3'          uauaaa c g gac  gacu gguucg ccgac cuauuc aag u
   -----caaa      - u u   uu    a      u     a      u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB201304.1: 4520058-4520158 [+]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-2d
lgi-mir-71KB201304.1: 4515783-4515883 [-]
lgi-mir-2dKB201304.1: 4520058-4520158 [+]
Database links

Mature sequence lgi-miR-2d

Accession MIMAT0009559
Sequence

61 - 

uaucacagccugcuuggaucagu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).