Stem-loop sequence lgi-mir-2c

AccessionMI0010101 (change log)
DescriptionLottia gigantea miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   acauuaccggua          u c        -             uuaa 
5'             uuuauggaga c cauuaaag ugguugugaugug    a
               |||||||||| | |||||||| |||||||||||||     
3'             aaauauuucu g guaguuuc accgacacuauac    u
   ----acuaaaac          u a        g             uacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB201304.1: 5780813-5780911 [+]
intergenic
Database links

Mature sequence lgi-miR-2c

Accession MIMAT0009558
Sequence

59 - 

uaucacagccagcuuugaugagu

 - 81

Get sequence
Evidence by similarity; MI0000118

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).