Stem-loop sequence lgi-mir-1

AccessionMI0010100 (change log)
DescriptionLottia gigantea miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   guau           ca         c    u  c     uuuua 
5'     cuguaugcaga  acauacuuc uugc au ccaua     u
       |||||||||||  ||||||||| |||| || |||||     a
3'     gguauguguuu  uguaugaag aaug ua gguau     u
   uuuu           ua         a    -  a     cguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB199650.1: 5198452-5198543 [-]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-1
lgi-mir-1KB199650.1: 5198452-5198543 [-]
lgi-mir-133KB199650.1: 5190436-5190510 [-]
Database links

Mature sequence lgi-miR-1

Accession MIMAT0009557
Sequence

56 - 

uggaauguaaagaaguauguau

 - 77

Get sequence
Evidence by similarity; MI0000437

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).